BLAST Tutorial for a Potato 🍟| Biopython Tutorial | Mr. BioinformatiX
Welcome to our comprehensive tutorial on using BLAST (Basic Local Alignment Search Tool) in Python, your gateway to the exciting world of bioinformatics! In this video, we'll guide you through the essentials of BLAST and show you how to harness its powerful capabilities to analyze DNA and protein sequences. 🔬 What You'll Learn: 1️⃣ Introduction to BLAST: We'll begin by explaining the significance of BLAST in bioinformatics, highlighting its role in identifying sequence similarities and functional annotations. 2️⃣ Python Libraries: Discover the Python libraries and tools essential for BLAST analysis, including Biopython, and how to effectively use them for sequence manipulation and analysis. 3️⃣ Sequence Retrieval: Learn how to retrieve sequence data from public databases or your own datasets, preparing them for BLAST analysis. 4️⃣ Running BLAST: Dive into the mechanics of running BLAST searches, whether you're interested in nucleotide or protein sequence alignments. 5️⃣ Analyzing BLAST Results: Interpret BLAST results and understand key parameters like E-values, sequence alignments, and sequence identity, gaining insights into the significance of your findings. Whether you're new to bioinformatics or looking to expand your knowledge, this video will equip you with the skills to perform BLAST analyses in Python, enabling you to uncover valuable insights from DNA and protein sequences. Don't forget to like, subscribe, and hit the notification bell to stay updated with more bioinformatics tutorials and tips. Let's dive into the fascinating world of BLAST and Python, where your exploration of genetic data begins! 🧬🔍🐍 #Bioinformatics #BLAST #Python #SequenceAnalysis #Genomics #Biopython #dna #dnaanalysis #ncbi #bioinformaticsforbeginners #mrbioinformatix Query_Sequence: “ACTGCTGATCGATCGATCGTAGCTAGCTAGCTAGCTAGCTAGCTAG” Bio BLAST Documentation: https://biopython.org/docs/1.75/api/Bio.Blast.html Subscribe | - TikTok Account: https://www.tiktok.com/@mrbioinformatix?is_from_webapp=1&sender_device=pc - Instagram Account : https://www.instagram.com/mr.bioinformatix_?igsh=MWxrY21qaDhvNHV6MQ==
Download
1 formatsVideo Formats
Right-click 'Download' and select 'Save Link As' if the file opens in a new tab.